PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Solanum tuberosum |
| GQS Type | G2L1-4 |
| No of (G) repeats | 6 |
| No of L bases | 3 |
| Sequence | CCAACCCCTACCCCCACCCCC |
| Chromosome | Chr1 |
| Strand | - |
| Start position (bp) | 84551116 |
| End position (bp) | 84551136 |
| Length (bp) | 21 |
| Gene ID | PGSC0003DMT400066607 |
| Genomic feature | intron |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
