PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Solanum lycopersicum |
| GQS Type | G2L1-2 |
| No of (G) repeats | 4 |
| No of L bases | 1 |
| Sequence | CCCCTCCTTTGCCTGCGCCC |
| Chromosome | Chr1 |
| Strand | - |
| Start position (bp) | 76781332 |
| End position (bp) | 76781351 |
| Length (bp) | 20 |
| Gene ID | Solyc01g067800.2.1 |
| Genomic feature | intron |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
