PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Phaseolus vulgaris |
| GQS Type | G2L1 |
| No of (G) repeats | 7 |
| No of L bases | 4 |
| Sequence | GGTGGCGGCGGCGGCGGCGG |
| Chromosome | Chr05 |
| Strand | + |
| Start position (bp) | 40520458 |
| End position (bp) | 40520477 |
| Length (bp) | 20 |
| Gene ID | Phvul.005G185100 |
| Genomic feature | CDS, exon, gene, mRNA |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
