PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Populus trichocarpa |
| GQS Type | G2L1-4 |
| No of (G) repeats | 4 |
| No of L bases | 1 |
| Sequence | GGTCATGGCTCTGGCAGTGG |
| Chromosome | Chr05 |
| Strand | + |
| Start position (bp) | 25755750 |
| End position (bp) | 25755769 |
| Length (bp) | 20 |
| Gene ID | Potri.005G258600 |
| Genomic feature | CDS, exon, gene, mRNA |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
