PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Oryza sativa |
| GQS Type | G2L1 |
| No of (G) repeats | 6 |
| No of L bases | 3 |
| Sequence | GGCGGCGGTGGGTGGCGGGG |
| Chromosome | Chr1 |
| Strand | + |
| Start position (bp) | 42949502 |
| End position (bp) | 42949521 |
| Length (bp) | 20 |
| Gene ID | LOC_Os01g74146 |
| Genomic feature | exon, five_prime_UTR, gene, mRNA |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
