PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Oryza glumaepatula |
| GQS Type | G2L1 |
| No of (G) repeats | 8 |
| No of L bases | 5 |
| Sequence | GGTGGCGGCGGCGGCGGCGGTGG |
| Chromosome | Chr7 |
| Strand | + |
| Start position (bp) | 25257343 |
| End position (bp) | 25257365 |
| Length (bp) | 23 |
| Gene ID | OGLUM07G23490.2 |
| Genomic feature | TTS |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
