PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Oryza glumaepatula |
| GQS Type | G2L1-4 |
| No of (G) repeats | 6 |
| No of L bases | 3 |
| Sequence | GGGCTGGGCGGCGGGGACGGAGG |
| Chromosome | Chr6 |
| Strand | + |
| Start position (bp) | 4097018 |
| End position (bp) | 4097040 |
| Length (bp) | 23 |
| Gene ID | OGLUM06G05740.1 |
| Genomic feature | Intergenic |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
