PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Oryza glumaepatula |
| GQS Type | G3L1-7 |
| No of (G) repeats | 4 |
| No of L bases | 1 |
| Sequence | CCCACCCTCTTCTTCCCTTTCCC |
| Chromosome | Chr1 |
| Strand | - |
| Start position (bp) | 29656432 |
| End position (bp) | 29656454 |
| Length (bp) | 23 |
| Gene ID | EPlOGLuT00000002878 |
| Genomic feature | Intergenic |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
