PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Medicago truncatula |
| GQS Type | G2L1-4 |
| No of (G) repeats | 5 |
| No of L bases | 2 |
| Sequence | CCTCCCTACCTTTCCCTCTCCC |
| Chromosome | chr7 |
| Strand | - |
| Start position (bp) | 25166734 |
| End position (bp) | 25166755 |
| Length (bp) | 22 |
| Gene ID | Medtr7g068630 |
| Genomic feature | CDS, exon, gene, mRNA |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
