PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Musa acuminata |
| GQS Type | G2L1-4 |
| No of (G) repeats | 6 |
| No of L bases | 3 |
| Sequence | GGTGGCGGCGGTGGACACGGG |
| Chromosome | Chr7 |
| Strand | + |
| Start position (bp) | 24073902 |
| End position (bp) | 24073922 |
| Length (bp) | 21 |
| Gene ID | GSMUA_Achr7T21240_001 |
| Genomic feature | exon |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
