PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Leersia perrieri |
| GQS Type | G2L1 |
| No of (G) repeats | 8 |
| No of L bases | 5 |
| Sequence | GGCGGCGGCGGAGGTGGAGGGGGG |
| Chromosome | Chr9 |
| Strand | + |
| Start position (bp) | 7874703 |
| End position (bp) | 7874726 |
| Length (bp) | 24 |
| Gene ID | LPERR09G06240.1 |
| Genomic feature | promoter-TSS |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
