PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Lotus japonicus |
| GQS Type | G2L1-2 |
| No of (G) repeats | 7 |
| No of L bases | 4 |
| Sequence | GGAGGAGGAGGTGGTGGCTGG |
| Chromosome | Chr5 |
| Strand | + |
| Start position (bp) | 14334476 |
| End position (bp) | 14334496 |
| Length (bp) | 21 |
| Gene ID | |
| Genomic feature | Intergenic |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
