| Plant | Lotus japonicus | 
| GQS Type | G2L1 | 
| No of (G) repeats | 7 | 
| No of L bases | 4 | 
| Sequence | CCACCGCCGCCGCCGCCGCCC | 
| Chromosome | Chr2 | 
| Strand | - | 
| Start position (bp) | 16558506 | 
| End position (bp) | 16558526 | 
| Length (bp) | 21 | 
| Gene ID | |
| Genomic feature | Intergenic | 
 Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
		
       Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS 
