PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Glycine max |
| GQS Type | G2L1-4 |
| No of (G) repeats | 5 |
| No of L bases | 2 |
| Sequence | CCACTGCCACCATTTCCCACC |
| Chromosome | Chr18 |
| Strand | - |
| Start position (bp) | 10297116 |
| End position (bp) | 10297136 |
| Length (bp) | 21 |
| Gene ID | 18g11551 |
| Genomic feature | CDS, exon, gene, mRNA |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
