PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Cyanidioschyzon merolae |
| GQS Type | G2L1 |
| No of (G) repeats | 6 |
| No of L bases | 3 |
| Sequence | CCACCGCCCGCCCGCCCGCCC |
| Chromosome | 12 |
| Strand | - |
| Start position (bp) | 663337 |
| End position (bp) | 663357 |
| Length (bp) | 21 |
| Gene ID | CML258CT |
| Genomic feature | TTS |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
