| Plant | Cyanidioschyzon merolae |
| GQS Type | G2L1 |
| No of (G) repeats | 13 |
| No of L bases | 10 |
| Sequence | CCACCGCCACCGCCCCCGCCACCGCCACCGCCACCGCC |
| Chromosome | 19 |
| Strand | - |
| Start position (bp) | 463612 |
| End position (bp) | 463649 |
| Length (bp) | 38 |
| Gene ID | CMS176CT |
| Genomic feature | exon |