| Plant | Cyanidioschyzon merolae | 
| GQS Type | G2L1-4 | 
| No of (G) repeats | 5 | 
| No of L bases | 2 | 
| Sequence | CCGATACCACCACCTGCCCC | 
| Chromosome | 20 | 
| Strand | - | 
| Start position (bp) | 363738 | 
| End position (bp) | 363757 | 
| Length (bp) | 20 | 
| Gene ID | CMT134CT | 
| Genomic feature | exon | 
 Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
		
       Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS 
