| Plant | Cyanidioschyzon merolae | 
| GQS Type | G2L1-4 | 
| No of (G) repeats | 4 | 
| No of L bases | 1 | 
| Sequence | GGTATGGGACTCGGGCGTGG | 
| Chromosome | 11 | 
| Strand | + | 
| Start position (bp) | 362126 | 
| End position (bp) | 362145 | 
| Length (bp) | 20 | 
| Gene ID | CMK134CT | 
| Genomic feature | promoter-TSS | 
 Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
		
       Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS 
