PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Arabidopsis lyrata |
| GQS Type | G3L1-3 |
| No of (G) repeats | 4 |
| No of L bases | 1 |
| Sequence | GGGTTCGGGTTCGGGTCGGG |
| Chromosome | Chr8 |
| Strand | + |
| Start position (bp) | 13516223 |
| End position (bp) | 13516242 |
| Length (bp) | 20 |
| Gene ID | fgenesh2_kg.8__857__AT5G49820. |
| Genomic feature | TTS |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
