PlantG4DB: A Database of G-Quadruplex Sequences in Plants
| Plant | Arabidopsis lyrata |
| GQS Type | G2L1-4 |
| No of (G) repeats | 5 |
| No of L bases | 2 |
| Sequence | GGTCAGGGAAGAGGTGGTGTGGG |
| Chromosome | Chr1 |
| Strand | + |
| Start position (bp) | 3104017 |
| End position (bp) | 3104039 |
| Length (bp) | 23 |
| Gene ID | fgenesh1_pm.C_scaffold_1000660 |
| Genomic feature | exon |
Copyright © 2016 School of Computational & Integrative Sciences, Jawaharlal Nehru University, India | SCIS
